BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= Test (560 letters) Database: ecoli.nt 400 sequences; 4,662,239 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gb|AE000111.1|AE000111 Escherichia coli K-12 MG1655 section 1 of... 589 e-168 gb|AE000440.1|AE000440 Escherichia coli K-12 MG1655 section 330 ... 32 0.51 gb|AE000132.1|AE000132 Escherichia coli K-12 MG1655 section 22 o... 32 0.51 gb|AE000387.1|AE000387 Escherichia coli K-12 MG1655 section 277 ... 30 2.0 gb|AE000295.1|AE000295 Escherichia coli K-12 MG1655 section 185 ... 30 2.0 gb|AE000279.1|AE000279 Escherichia coli K-12 MG1655 section 169 ... 30 2.0 gb|AE000167.1|AE000167 Escherichia coli K-12 MG1655 section 57 o... 30 2.0 gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of... 30 2.0 gb|AE000115.1|AE000115 Escherichia coli K-12 MG1655 section 5 of... 30 2.0 gb|AE000510.1|AE000510 Escherichia coli K-12 MG1655 section 400 ... 28 8.0 gb|AE000496.1|AE000496 Escherichia coli K-12 MG1655 section 386 ... 28 8.0 gb|AE000494.1|AE000494 Escherichia coli K-12 MG1655 section 384 ... 28 8.0 gb|AE000488.1|AE000488 Escherichia coli K-12 MG1655 section 378 ... 28 8.0 gb|AE000483.1|AE000483 Escherichia coli K-12 MG1655 section 373 ... 28 8.0 gb|AE000467.1|AE000467 Escherichia coli K-12 MG1655 section 357 ... 28 8.0 gb|AE000463.1|AE000463 Escherichia coli K-12 MG1655 section 353 ... 28 8.0 gb|AE000441.1|AE000441 Escherichia coli K-12 MG1655 section 331 ... 28 8.0 gb|AE000426.1|AE000426 Escherichia coli K-12 MG1655 section 316 ... 28 8.0 gb|AE000407.1|AE000407 Escherichia coli K-12 MG1655 section 297 ... 28 8.0 gb|AE000399.1|AE000399 Escherichia coli K-12 MG1655 section 289 ... 28 8.0 gb|AE000380.1|AE000380 Escherichia coli K-12 MG1655 section 270 ... 28 8.0 gb|AE000371.1|AE000371 Escherichia coli K-12 MG1655 section 261 ... 28 8.0 gb|AE000336.1|AE000336 Escherichia coli K-12 MG1655 section 226 ... 28 8.0 gb|AE000332.1|AE000332 Escherichia coli K-12 MG1655 section 222 ... 28 8.0 gb|AE000303.1|AE000303 Escherichia coli K-12 MG1655 section 193 ... 28 8.0 gb|AE000298.1|AE000298 Escherichia coli K-12 MG1655 section 188 ... 28 8.0 gb|AE000293.1|AE000293 Escherichia coli K-12 MG1655 section 183 ... 28 8.0 gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 ... 28 8.0 gb|AE000269.1|AE000269 Escherichia coli K-12 MG1655 section 159 ... 28 8.0 gb|AE000266.1|AE000266 Escherichia coli K-12 MG1655 section 156 ... 28 8.0 gb|AE000250.1|AE000250 Escherichia coli K-12 MG1655 section 140 ... 28 8.0 gb|AE000230.1|AE000230 Escherichia coli K-12 MG1655 section 120 ... 28 8.0 gb|AE000212.1|AE000212 Escherichia coli K-12 MG1655 section 102 ... 28 8.0 gb|AE000190.1|AE000190 Escherichia coli K-12 MG1655 section 80 o... 28 8.0 gb|AE000183.1|AE000183 Escherichia coli K-12 MG1655 section 73 o... 28 8.0 gb|AE000161.1|AE000161 Escherichia coli K-12 MG1655 section 51 o... 28 8.0 gb|AE000155.1|AE000155 Escherichia coli K-12 MG1655 section 45 o... 28 8.0 >gb|AE000111.1|AE000111 Escherichia coli K-12 MG1655 section 1 of 400 of the complete genome Length = 10596 Score = 589 bits (297), Expect = e-168 Identities = 315/324 (97%) Strand = Plus / Plus Query: 237 aggtaacggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtg 296 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 237 aggtaacggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtg 296 Query: 297 cgggcnnnnnnnnncgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcgg 356 ||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 297 cgggctttttttttcgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcgg 356 Query: 357 cggtacatcagtggcaaatgcagaacgttttctgcgtgttgccgatattctggaaagcaa 416 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 357 cggtacatcagtggcaaatgcagaacgttttctgcgtgttgccgatattctggaaagcaa 416 Query: 417 tgccaggcaggggcaggtggccaccgtcctctctgcccccgccaaaatcaccaaccacct 476 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 417 tgccaggcaggggcaggtggccaccgtcctctctgcccccgccaaaatcaccaaccacct 476 Query: 477 ggtggcgatgattgaaaaaaccattagcggccaggatgctttacccaatatcagcgatgc 536 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 477 ggtggcgatgattgaaaaaaccattagcggccaggatgctttacccaatatcagcgatgc 536 Query: 537 cgaacgtatttttgccgaactttt 560 |||||||||||||||||||||||| Sbjct: 537 cgaacgtatttttgccgaactttt 560 Score = 361 bits (182), Expect = e-100 Identities = 196/203 (96%) Strand = Plus / Plus Query: 1 agcttttcattctgactgcaacgggcaatatgtctctgtgtggattnnnnnnngagtgtc 60 |||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 1 agcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtc 60 Query: 61 tgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgacttagg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgacttagg 120 Query: 121 tcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtac 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtac 180 Query: 181 acaacatccatgaaacgcattag 203 ||||||||||||||||||||||| Sbjct: 181 acaacatccatgaaacgcattag 203 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 274 aaaaaagcccgcac 287 |||||||||||||| Sbjct: 307 aaaaaagcccgcac 294 >gb|AE000440.1|AE000440 Escherichia coli K-12 MG1655 section 330 of 400 of the complete genome Length = 15529 Score = 32.2 bits (16), Expect = 0.51 Identities = 16/16 (100%) Strand = Plus / Minus Query: 496 accattagcggccagg 511 |||||||||||||||| Sbjct: 2689 accattagcggccagg 2674 >gb|AE000132.1|AE000132 Escherichia coli K-12 MG1655 section 22 of 400 of the complete genome Length = 10167 Score = 32.2 bits (16), Expect = 0.51 Identities = 16/16 (100%) Strand = Plus / Plus Query: 529 agcgatgccgaacgta 544 |||||||||||||||| Sbjct: 3468 agcgatgccgaacgta 3483 >gb|AE000387.1|AE000387 Escherichia coli K-12 MG1655 section 277 of 400 of the complete genome Length = 11307 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 519 acccaatatcagcga 533 ||||||||||||||| Sbjct: 10945 acccaatatcagcga 10931 >gb|AE000295.1|AE000295 Escherichia coli K-12 MG1655 section 185 of 400 of the complete genome Length = 20254 Score = 30.2 bits (15), Expect = 2.0 Identities = 18/19 (94%) Strand = Plus / Minus Query: 489 tgaaaaaaccattagcggc 507 |||||||||||| |||||| Sbjct: 6930 tgaaaaaaccatcagcggc 6912 >gb|AE000279.1|AE000279 Escherichia coli K-12 MG1655 section 169 of 400 of the complete genome Length = 10855 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 472 cacctggtggcgatg 486 ||||||||||||||| Sbjct: 2905 cacctggtggcgatg 2891 >gb|AE000167.1|AE000167 Escherichia coli K-12 MG1655 section 57 of 400 of the complete genome Length = 10264 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Minus Query: 9 attctgactgcaacg 23 ||||||||||||||| Sbjct: 7614 attctgactgcaacg 7600 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 273 gaaaaaagcccgca 286 |||||||||||||| Sbjct: 7686 gaaaaaagcccgca 7673 >gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of 400 of the complete genome Length = 13416 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 456 cgccaaaatcaccaa 470 ||||||||||||||| Sbjct: 2900 cgccaaaatcaccaa 2914 >gb|AE000115.1|AE000115 Escherichia coli K-12 MG1655 section 5 of 400 of the complete genome Length = 10102 Score = 30.2 bits (15), Expect = 2.0 Identities = 15/15 (100%) Strand = Plus / Plus Query: 475 ctggtggcgatgatt 489 ||||||||||||||| Sbjct: 1090 ctggtggcgatgatt 1104 >gb|AE000510.1|AE000510 Escherichia coli K-12 MG1655 section 400 of 400 of the complete genome Length = 6309 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 476 tggtggcgatgatt 489 |||||||||||||| Sbjct: 4291 tggtggcgatgatt 4304 >gb|AE000496.1|AE000496 Escherichia coli K-12 MG1655 section 386 of 400 of the complete genome Length = 11929 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 313 accaaaggtaacga 326 |||||||||||||| Sbjct: 8741 accaaaggtaacga 8728 >gb|AE000494.1|AE000494 Escherichia coli K-12 MG1655 section 384 of 400 of the complete genome Length = 11100 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 362 catcagtggcaaat 375 |||||||||||||| Sbjct: 5293 catcagtggcaaat 5280 >gb|AE000488.1|AE000488 Escherichia coli K-12 MG1655 section 378 of 400 of the complete genome Length = 10003 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 402 tattctggaaagca 415 |||||||||||||| Sbjct: 8176 tattctggaaagca 8163 >gb|AE000483.1|AE000483 Escherichia coli K-12 MG1655 section 373 of 400 of the complete genome Length = 10484 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 339 gcgagtgttgaagt 352 |||||||||||||| Sbjct: 3700 gcgagtgttgaagt 3687 >gb|AE000467.1|AE000467 Escherichia coli K-12 MG1655 section 357 of 400 of the complete genome Length = 15633 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 362 catcagtggcaaat 375 |||||||||||||| Sbjct: 1134 catcagtggcaaat 1147 >gb|AE000463.1|AE000463 Escherichia coli K-12 MG1655 section 353 of 400 of the complete genome Length = 10159 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 270 acagaaaaaagccc 283 |||||||||||||| Sbjct: 2092 acagaaaaaagccc 2079 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 396 tgccgatattctgg 409 |||||||||||||| Sbjct: 9587 tgccgatattctgg 9600 >gb|AE000441.1|AE000441 Escherichia coli K-12 MG1655 section 331 of 400 of the complete genome Length = 10562 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 164 taaaaattacagag 177 |||||||||||||| Sbjct: 10457 taaaaattacagag 10470 >gb|AE000426.1|AE000426 Escherichia coli K-12 MG1655 section 316 of 400 of the complete genome Length = 10240 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 67 cagcttctgaactg 80 |||||||||||||| Sbjct: 7018 cagcttctgaactg 7005 >gb|AE000407.1|AE000407 Escherichia coli K-12 MG1655 section 297 of 400 of the complete genome Length = 10601 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 72 tctgaactggttac 85 |||||||||||||| Sbjct: 4814 tctgaactggttac 4801 >gb|AE000399.1|AE000399 Escherichia coli K-12 MG1655 section 289 of 400 of the complete genome Length = 17801 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 393 tgttgccgatattc 406 |||||||||||||| Sbjct: 2398 tgttgccgatattc 2385 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 379 gaacgttttctgcg 392 |||||||||||||| Sbjct: 9048 gaacgttttctgcg 9061 >gb|AE000380.1|AE000380 Escherichia coli K-12 MG1655 section 270 of 400 of the complete genome Length = 13690 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 60 ctgatagcagcttc 73 |||||||||||||| Sbjct: 8526 ctgatagcagcttc 8539 >gb|AE000371.1|AE000371 Escherichia coli K-12 MG1655 section 261 of 400 of the complete genome Length = 11795 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 20 aacgggcaatatgt 33 |||||||||||||| Sbjct: 1100 aacgggcaatatgt 1113 >gb|AE000336.1|AE000336 Escherichia coli K-12 MG1655 section 226 of 400 of the complete genome Length = 13185 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 103 aaattttattgact 116 |||||||||||||| Sbjct: 858 aaattttattgact 871 >gb|AE000332.1|AE000332 Escherichia coli K-12 MG1655 section 222 of 400 of the complete genome Length = 12698 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 248 cgggctgacgcgta 261 |||||||||||||| Sbjct: 5994 cgggctgacgcgta 5981 >gb|AE000303.1|AE000303 Escherichia coli K-12 MG1655 section 193 of 400 of the complete genome Length = 11718 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 360 tacatcagtggcaa 373 |||||||||||||| Sbjct: 3904 tacatcagtggcaa 3917 >gb|AE000298.1|AE000298 Escherichia coli K-12 MG1655 section 188 of 400 of the complete genome Length = 12343 Score = 28.2 bits (14), Expect = 8.0 Identities = 17/18 (94%) Strand = Plus / Minus Query: 370 gcaaatgcagaacgtttt 387 ||||||||||| |||||| Sbjct: 7176 gcaaatgcagagcgtttt 7159 >gb|AE000293.1|AE000293 Escherichia coli K-12 MG1655 section 183 of 400 of the complete genome Length = 11717 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 342 agtgttgaagttcg 355 |||||||||||||| Sbjct: 1008 agtgttgaagttcg 1021 >gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 of 400 of the complete genome Length = 11855 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 409 gaaagcaatgccag 422 |||||||||||||| Sbjct: 4981 gaaagcaatgccag 4994 >gb|AE000269.1|AE000269 Escherichia coli K-12 MG1655 section 159 of 400 of the complete genome Length = 11007 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 188 ccatgaaacgcatt 201 |||||||||||||| Sbjct: 10338 ccatgaaacgcatt 10351 >gb|AE000266.1|AE000266 Escherichia coli K-12 MG1655 section 156 of 400 of the complete genome Length = 10558 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 379 gaacgttttctgcg 392 |||||||||||||| Sbjct: 6273 gaacgttttctgcg 6286 >gb|AE000250.1|AE000250 Escherichia coli K-12 MG1655 section 140 of 400 of the complete genome Length = 10480 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 412 agcaatgccaggca 425 |||||||||||||| Sbjct: 7136 agcaatgccaggca 7123 >gb|AE000230.1|AE000230 Escherichia coli K-12 MG1655 section 120 of 400 of the complete genome Length = 10118 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 186 atccatgaaacgca 199 |||||||||||||| Sbjct: 4204 atccatgaaacgca 4217 >gb|AE000212.1|AE000212 Escherichia coli K-12 MG1655 section 102 of 400 of the complete genome Length = 11749 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 370 gcaaatgcagaacg 383 |||||||||||||| Sbjct: 11045 gcaaatgcagaacg 11032 >gb|AE000190.1|AE000190 Escherichia coli K-12 MG1655 section 80 of 400 of the complete genome Length = 10051 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 155 acagacagataaaa 168 |||||||||||||| Sbjct: 3526 acagacagataaaa 3539 >gb|AE000183.1|AE000183 Escherichia coli K-12 MG1655 section 73 of 400 of the complete genome Length = 11029 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 274 aaaaaagcccgcac 287 |||||||||||||| Sbjct: 3997 aaaaaagcccgcac 3984 >gb|AE000161.1|AE000161 Escherichia coli K-12 MG1655 section 51 of 400 of the complete genome Length = 16170 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 16 ctgcaacgggcaat 29 |||||||||||||| Sbjct: 13270 ctgcaacgggcaat 13257 >gb|AE000155.1|AE000155 Escherichia coli K-12 MG1655 section 45 of 400 of the complete genome Length = 11593 Score = 28.2 bits (14), Expect = 8.0 Identities = 14/14 (100%) Strand = Plus / Minus Query: 325 gaggtaacaaccat 338 |||||||||||||| Sbjct: 9581 gaggtaacaaccat 9568 Database: ecoli.nt Posted date: Feb 22, 2007 10:17 AM Number of letters in database: 4,662,239 Number of sequences in database: 400 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 400 Number of Hits to DB: 25,815 Number of extensions: 1498 Number of successful extensions: 44 Number of sequences better than 10.0: 37 Number of HSP's gapped: 43 Number of HSP's successfully gapped: 43 Length of query: 560 Length of database: 4,662,239 Length adjustment: 16 Effective length of query: 544 Effective length of database: 4,655,839 Effective search space: 2532776416 Effective search space used: 2532776416 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits) S2: 14 (28.2 bits)